Annealing Temparature

Viewing 3 reply threads
  • Author
    Posts
    • #17743
      Helics
      Participant

      My Gene of Interest is 2kb long
      Primer-F : GCTCTAGAGTGATAGTAGGCATGG
      Primer-R : GCGATATCCTACACCCAAGCTGC

      I used the following program:

      94C 1min
      94C 2min
      56C 1min
      72C 2min

      final elongation 72C 7min

      I’m failed to amplify my gene of interest. please help me. 🙁 🙁 🙁 🙁 🙁

    • #115064
      JackBean
      Participant

      First, you seem to have big difference in the Tms, second the Tms seem to be quite high (62 – 69°C).

      Are you sure your denaturation in the beginning is only 1 min or is it a typo? Why do you have such long denaturation during cycling? Why do you have such long annealing? What polymerase do you use? What is the GC content of your GOI? How many cycles did you have? What is the template? What concentration did you use?

    • #115070
      Cat
      Participant

      According to NCBI this pair should not amplify anything anyway…

    • #115081
      Helics
      Participant

      Primer_F: 5′-GCTCTAGAGTGATAGTGAGCATGG-3′

      Primer_R: 5′-GCGATATCCTACACCCAAGCTGC-3′

      CORRECTED PRIMER SEQUENCE.

      THANKS ALL.
      I WILL TRY SUGGESTED EXP. CONDITION.

      THANKS "vladCH".

Viewing 3 reply threads
  • You must be logged in to reply to this topic.