DNA sequence, Nucleotide sequence – Sequence of 3870 nuc.

Viewing 3 reply threads
  • Author
    Posts
    • #18124
      SystemRGB
      Participant

      Visualization of DNA sequence invented in 2015 by Polish scientist Gregory Podgorniak, above sequence of 3870 nucleotides –

      ATCCTTGTTATTGCAGTAGCTCAGTACTTGCACGTGATGGGGCGCGTACACTGGAGACACGTCTTGATATTTAA ACCTTGCTCCAGCCCGGCTACAGCAGAAGACCGCAACAGTCGTGCTGACCAGTTAGAAAGATGATATGTGCGCA GCTTTTAACAGGGTGCCCCGTGGAACAGTCCTGTCGACTACAAAGGATGCGTTATCAGTCCCACCATCTCAGCG TGTTCGCCCATTACTAAGCTACACGGCGCAATAGCGGGGGACGCGCCGCCCCCCGATAACGATCATGTTGGGTA GGGACAGTCACAACGGTCTCCTGTTTACTAACAATTCATGTCAACACGCCATCTTACATGGTGTGACTGTCTAA GGGGCGGGCGGTTTCCTACAACTCCGAAGTAATTCCCTCTGTCAGTATCACAGATGCCAAAGAATTCTATCTGA ACCAGCACAGCTAAAATACATGCTCCGTAGGCCACTTTCGCAAATCCAAATGCGATAATTTATCTTAAGACTGC ATCTGCAAACCCAGGCCCGGGGTGATAGCTCTCATCTGAATATAACGTGTGCCAAAGCGCGTGGCCGAGCTCAT TTCAAGCCAACATTCGCATGTCGTGGAAGTTCGTCACCAGGCCATAGATACTTACATAAGCCGGAAAGTACACC ATCAGGCGAGCTAGTCATCACGGTTACTGGGGATTCATGCGTGGCGACTGTTCCAAAAGTTGCCATACGGCAGG ACCTTTTATTTTCTGGTACAGACGTCACCGCAATCTTCTAACTACTAACGGCGCTAAAACTCTGCGCAAGTCAG TTGGGTCTTTCTATGATATAACATGTCGTAACTGACATTAAGAGTTGCGCGTATAACTGCGAATAGACTGCATA GCTCGTCCTAGAACTATCATGGTGTACGGCATCGCTCTGACACTTATTATTCTTGGCTCTGGCTTAATATCCCC GTCGATCCCAGCGTCTCCAAGTCGTACTTCCGTGGTTGTCATCTCATTCCCAGAGTGCGGGTCAGCGAATATCT TACGTACCCCTGCCGAAGTCGTACCCCCGAGCTTCGGTATCTCATATAGTGTCGGCGGCACGACTGGGCTCGGG AGCTCGGAAGTTGGATAAATCATATGTGACGAGTCCAGAAAGTTCAGTATAGCCTTGGTGTTTCCAATGGTTCT CATGTCGTGGCCGAAGTCGAGCTCCTCTTAGCCCGCAGGAACAAACGAGGGCTACGTACAGGGTTGTCAGTGTA ATTAAAGTATCGCCGAGACTCTAGTCGGCAGAGAAACCAGTTGGCCTGTTCCCTTCTCTACCCGACCCTCTTAC TTGTGATAATATGTACAAATTACCCGGAAAATAGAGTCGCAAATCAGACGGCAGAAGTCGTAGTATCAGTTTAT TTATTTTATCATTGACTCTGGCCGTAGTACTTTTTCGTCGGTTACCCCCTGCTGATCCTGAAACGAACCCACAC GAAAGTTCTAGCGAAACAGCGGATCTGCGCCCCGTTTTGGGTACGGTGTAATTGTACGCCTGAACTGATACGGC ACAGGTCGGTTCAATCCGTTTCCCCGGATCTCACGTCATAGGACCTATGAGTAGGTAGGTCTTAAAAGATAATG ATTCTGAGGGCTATCACAGCATAATTATTTGTTACAGACGACATTCTCATATTTTCCTGCTTTGCAGGAAAGAG TATTGAACCGCTGAGGAATTACCCACGTGTTGCCAGGCAAGAGACGGCCAGGAATCGCCACGGATTGGGCACAT GACGTCGCGGACAACCCAGAATTGTCTTGAGCGATGGTAAGATCTAACCTCACTGCCGGGGGAGGCTCATACCT GGGGCTTTACTGATGTCATACCGTCTTGCACGGGGATAGAATGACGGTGCCCGTGTCTGCTTGCCTCGAAGCAA TTTTCTGAAAGTTACAGACTTCGATTAAAAAGATCGGACTGCGCGTGGGCCCGGAGAGACATGCGTGGTAGTCA TTTTTCGACGTGTCAAGGACTCAAGGGAATAGTTTGGCGGGAGCGTTACAGCTTCAATTCCCAAAGGTCGCAAG ACGATAAAATTCAACTACTGGTTTCGGCCTAATAGGTCACGTTTTATGTGAAATAGAGGGGAACCGGCTCCCAA ATCCCTGGGTGTTCTATGATAAGTCCTGCTTTATAACACGGGGCGGTTAGGTTAAATGACTCTTCTATCTTATG GTGATCCAAGCGCCCGCTAATTCTGTTCTGTTAATGTTCATACCAATACTCACATCACATTAGATCAAAGGATC CCCGAGCCCAGTCGCAAGGGTCTGCTGCTGTTGTCGACGCCTCATGTTACTCCTGGAATCTACCTGCCCTCCCC TCACCGGTTAAGGCGTGTGATCGACGATGCAGGTATACATCGGCTCGGACCTACAGTGGTCGATCGACTGGCTA CTGGCTTCGCGGTTCGGCGCGTAGTTGAGTGCGATAACCCAACCGGTGGCAAGTAGCAAGAAGACCTACCTGGG TCACCTTAGACAACCTAACTAATAGTCTCTAACGGGGAATTACCTTTACCAGTCTCATGCCTCCAATATATCTG CACCGCTTCAATGATATCGCCCACAGAAAGTAGGGTCTCAGGTATCGCATACGCCGCGCCCGGGTCCCAGCTAC GCTCAGGACGACAGTAGAGAGCTATTGTGTAATTCAGGCTCAGCATTCATCGACCTTTCCTGTTGTGAATATTG TGCTAATGCATCTCGTCCGTAACGATCTGGGGGGCAAAACCGAATATCCGTATTCTCGTCCTACGGGTCCACAA TGAGAAAGTCCTGCGCGTGATCGTCAGTTAAGTTAAATTAATTCAGGCTACGGTAAACTTGTAGTGAGCTAAGA ATCACGGGAATCACGGGTTCGCTACAGATGAACTGAATTTATACACGGACAACTCATCGCCCATTTGGGCGTGG GCACCGCAGATCAAAAGTGGCAGATTAGGAGTGCTTGATCAGGTTAGCAGGTGGACTGTATCCAACAGCGCATC AAACTTCAATAAATCCAAAGCGTTGTAGTGGTCTAAGCACCCCTGAACAGTGGCGCCCATCGTTAGCGTAGTAC AACCCTTCCCCCTTGAGGTGCGACATGGGGCCAGTTAGCCTGCCCTATATCCCTTGCACACGTTCAATAAGAGG GGCTCTACAGCGCCGCTTTTTAAATTAGGATGCCGACCCCATCATTGGTAACTGTATGTTCATAGATATTTCTT CAGGAGTAATAGCGACAAGCTGACACGCAAGGGTCAACAATAATTTCTACTATCACCCCGCTGAACGACTGTCT TTGCAAGAACCAACTGGGCTTAGATTCGCGTCCTAACGTAGTGAGGGCCGAGTCATATCATAGATCAGGCATGA GAAACCGACGTCGAGTCTACACACGAGTTGTAAACAACTTGATTGCTATACTGTAGCTACCGCAAGGATCTCCT ACATCAAAGACTACTGGGCGATCTGGATCCGAGTCAGAAATACGAGTTAATGCAAATTTACGTAGACCGGTGAA AACACGTGCCATGGGTTGCGTAGACCGTAGTCAGAAGTGTGGCGCGCTATTCGTACCGAACCGGTGGAGTATAC AGAATTGCTCTTCTACGACGTAAGGAGCTCGGTCCCCAATGCACGCCAAAAAAGGAATAAAGTATTCAAACTGC GCATGGTCCCTCCGCCGGTGGCACTATTATCCATCCGAACGTTGAACCTACTTCCTCGGCTTATGCTGTCCTCA ACAGTATCGCTTATGAATCGCATGCGGCTGTGGATCTTAACGGCCACATTCTTAATTCCGACCGATCACCGATC
      GCCTTTCCTCGCTGGTACAATG

      see site V – DNA, nucleotide sequence, numeral system http://studia.scienceontheweb.net/visualization.php

    • #115782
      SystemRGB
      Participant

      whole sequence:

    • #115790
      SystemRGB
      Participant

      This type of sequence can be a recording of complete genome of ssDNA (single stranded DNA) virus. For example Porcine circovirus-1 from the genus Circovirus has a single-chain genome of 1759 nucleotides long.

    • #116427
      SystemRGB
      Participant

      see this again

Viewing 3 reply threads
  • You must be logged in to reply to this topic.