fusion PCR

Viewing 20 reply threads
  • Author
    Posts
    • #7480
      Ammie
      Participant

      Anyone that have any experiences with fusion PCR?

      I have many overlapping fragment at about 1000bp that I want to ligate. Some authors write that this method is better than cut and paste with restriction enzymes and ligase.

      It sounds easy in theory but it is in real world?

    • #71415
      blcr11
      Participant

      I’m not sure I’m familiar with the term “fusion PCR.” From your description it sounds like a synthetic gene application where you use PCR to assemble a gene from overlapping oligonucleotides. I think the technology sounds great. I want to use it myself, but it hasn’t worked very well for me—yet. There are a number of protocols out there for doing this—I’ve tried a couple of them, alas, without much success. The basic problem is that I never see any full-length, amplified final product—just small mw bands and smears up to (and sometimes beyond) where I expect to see a clear band. I figure I’m missing something subtle about the protocols and/or I’m making mistakes when I dilute out the oligos, or there’s something wrong with the oligos I’ve ordered, either in my design or in the way they’ve been processed. There are companies that will make the gene for you—for a fee; it will cost 1-2 USD per basepair. There are webservers and free software that can help you design your oligonucleotides, too. Search Pubmed or google "codon optimization" or "synthetic gene" and you’ll get a sampling of what’s out there.

      Of course, it this isn’t what you’re talking about, this is all nonsense to you.

    • #71658
      justinjun
      Participant
      quote Ammie:

      Anyone that have any experiences with fusion PCR?

      I have many overlapping fragment at about 1000bp that I want to ligate. Some authors write that this method is better than cut and paste with restriction enzymes and ligase.

      It sounds easy in theory but it is in real world?

      Yes, that what I’m doing everyday.
      It’s easy way to stitch two fragments which have overlapping region together(or what you called as fusion or ligation, whatever).
      But, there is one thing you should pay attention to: the melting temperature should be similar or higher than the Tm of your primers (the better way: two Tm is close to each other). Otherwise, when u running PCR, the overlapping region cannot anneal together. Of coz u cannot get any correct amplicon or u just get some low MW smears.
      About primer design, there are tons of free-program you can choose. Usually, I like to use Primer3 (web-based,freeeeeeee)

    • #71672
      Ammie
      Participant

      I made a little trial… mixed two products together and I got a third. (and some weak unspecific bands) Did not look at the melting temperature of the overlapping sequences, only the primers. But I will do that now.

      I have used primer3 to design primers earlier.

      But why do people use restrictionenzymes and ligase when this seems to be much more easy?

      Thanks for the tips justinjun, do you have any more?

    • #71963
      justinjun
      Participant
      quote Ammie:

      I made a little trial… mixed two products together and I got a third. (and some weak unspecific bands) Did not look at the melting temperature of the overlapping sequences, only the primers. But I will do that now.

      I have used primer3 to design primers earlier.

      But why do people use restrictionenzymes and ligase when this seems to be much more easy?

      Thanks for the tips justinjun, do you have any more?

      Check out this paper: "PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic C. elegans".
      After digest this paper, u’ll find out the answer by yourself.

    • #94094
      Dannyboy
      Participant

      I do this process routinely and have very good success with the method I have developed. It uses IDTs Oligo Analyzer and Microsoft Word to design primers for making fusions, that are injected and analyzed by microscopy for GFP expression. I have a protocol typed up if anyone is still looking for this kind of information.

    • #97731
      Dakota
      Participant

      I would appreciate the protocol, if you’re willing to give it out, with many thanks. I have spent the last month trying to figure out why my fusion is not sticking; I’m about to give up on it, but before I do I want to try redesigning primers, and seeing if I can get some other primer to take. Any tips anyone may have, I’d be glad to hear.

    • #98519
      Totor
      Participant

      Hello Dannyboy ,
      I am also interested by your protocol, for designing 5′ tails of oligos, for PCR fusions of multiple fragments, while avoiding unwanted cross-talks between fragment assembly.
      Best,
      Totor

    • #98988
      jackliu
      Participant

      I’m doing this these days,but I always got a smear 🙁 when fusing "A"(~250bp) to "B"(~3K).I tried many times but still failed to get the sequence wanted.I’d appreciate the protocol and any suggestions. Thanks a lot.

    • #98995
      JackBean
      Participant

      3 kbp are fairly a lot. Do you have proper protocol for amplification of long pieces?

    • #98997
      jackliu
      Participant
      quote JackBean:

      3 kbp are fairly a lot. Do you have proper protocol for amplification of long pieces?

      I use a High-fidelity DNA Polymerase–KOD-Plus-(TOYOBO CO., LTD.).Long targets ranging in size from 0.6 to 3.6 kb were amplified well according to its product introduction. I followed their protocol and there was no problem in amplification of 3kb pieces.Just stuck in the junction of the two pieces.

    • #99009
      JackBean
      Participant

      KOD Plus, that seems fine. I guess you can’t try you primer pair with some positive control, can you? How many steps in cycling are you using?

    • #99141
      jackliu
      Participant
      quote JackBean:

      KOD Plus, that seems fine. I guess you can’t try you primer pair with some positive control, can you? How many steps in cycling are you using?

      Thank you for reminding me to try my primers. I have tried them and find that they don’t work in my PCR system even degrade the Tm to 50 Celsius(no pieces in positive control ; smear in my fusion sample ). I’m examining my template as well though it worked well in amplifing a 3k fragment.
      One-step and Two-step were used but no result was achieved. Upset… 🙁

    • #99659
      Sorange
      Participant

      I’ve tried overlap PCR for months, however, yet to success. I’d like to fusion 3 fragments, 2.2+0.7+0.8. I fused the first two (3K, and it successed), and added 0.8 later. By using phusion polymerase, a band near 4K appeared(not quiet sharp but repeatable). After doing gel extraction, I failed to produce the 3.8K product by using it as DNA template with neither the ended primer pairs nor the nested primer pairs(should be 3.5K). I also used this gel extraction product to clone by TOPO blunt end kit, but only fragments (2.2, 0.7, 0.8 )were screened. is it possible that my 3.8K product is unstable and break into original pieces after gel extraction? or the large ends of full length product were missing and this could lead to the failure of nested PCR? PLEASE give me some advices or suggestions, it would a great help for me. Thanks!

    • #99662
      JackBean
      Participant

      did you run the gel properly? Did you separate the bands? I see it in wrong gel extraction, as I don’t see any reason, why should it break into your original pieces. Now they are just one piece 😉

    • #99774
      Sorange
      Participant

      thank you, JackBean. Although I’m confident with this gel extraction part, I’ll try it again later! BTW, do you ever see any unstable situation at the end of the overlapping product? I mean could it be possible that strong exonucleusae activity may degrade the product?

    • #100105
      bengen
      Participant

      Hey!

      I also got a big problem with fusion PCR, already posted here, because i saw this topic too late.
      about18892.html

      Well, i want to fuse 2 Fragments, one with 1,1 kb, and a second with 1,3 kb. So I amplify the original fragments with Phusion-Polymerase, and got a good yield.
      Then purification of the product, and starting to fuse them.

      The overlapping primers are:
      First fragment 3′
      CATATCCGTCGACGCATTGAATATTTTATTCCCATTTGTACCCAA

      Second fragment 5′
      AATATTCAATGCGTCGACGGATATG

      Bold is the overlapping region.

      Now i tried many combinations with Taq, Phusion, and Pfu Polymerase. Different annealing temps from 52-59 degrees celcius. With a lof of template, with less template. Don’t know what to do, really need a good advise :).

      Thank you very much,
      Ben

    • #100760
      rubyarch
      Participant

      In reply to Bengen:
      Wondering if you’ve had any success yet. I’m also trying to anneal and amplify a 1.9 kb and 0.8 kb which have about 30bp of overlap. I’ve also tried PfuUltra and DreamTaq polymerases using from 30ng up to 110ng of each template product (the 1.9 and 0.8 kb fragments), while keeping my end primers at 1uM. Hope you’ve had a breakthrough 😀 and if so, what worked?
      If I get mine to work, I’ll post… Thanx!

    • #106114
      Falko
      Participant

      you can do a simple PCR including the intron. The cells should splice it as normal.

    • #106116
      JackBean
      Participant
      quote Falko:

      you can do a simple PCR including the intron. The cells should splice it as normal.

      depends what cells. E.g. bacteria won’t splice it at all, since they don’t have any splicing machinery and even if you put it into other eukaryotic organism, it may splice it differently.

    • #107106
      qjiang
      Participant

      Hi,Sorange .I have the same problem like you.I want to fusion two flagments with the size of 0.8 and 2.9Kb.the overlapping size is 24bp,Tm 54C,Phusion enzyme.I successfully get the 0.8 and 2.9Kb fragments,but it dose not work when do fusion pcr.I wonder whether you have solve this problem later.I would appreciated it if someone can give me some advice .Thanks!

Viewing 20 reply threads
  • You must be logged in to reply to this topic.