Viewing 3 reply threads
  • Author
    Posts
    • #11499
      Melany87
      Participant

      Alright, I am struggling to find the informational DNA sequence and anti-sense DNA sequence to the resulting informational DNA sequence for the following mRNA sequence:

      5′ A AG G G U G U A G A A G C U A A G G G U 3′

      I contrived the following answers for information sequence, but I do not know if I am correct…
      3′ T TC C C A C A T C T A C G A T T C C C A 5′

      The resulting anti-sense would be:

      5′ A AG G T G T A G A T G C T A A G G G T 3′

      Is that right, or what because I have no found clear distinct guidance in my biology book concerning this…

      Any help or guidance is appreciated.

    • #91580
      Melany87
      Participant

      Ermm…. I noticed on the 2nd AA I stated TA instead of TT and, of course, the antisense would change subsequently.

    • #91596
      kolean
      Participant
      quote Melany87:

      5′ A AG G G U G U A G A A G C U A A G G G U 3′

      this is the mRNA, then the sense/coding DNA is the same, but the U’s are T’s in DNA:

      5′ A A G G G T G T A G A A G C T A A G G G T 3′

      the anti-sense/informational DNA is the opposite:

      3′ T T C C C A C A T C T T C G A T T C C C A 5′

      but most times it is written in the 5′ to 3′:

      5′ A C C C T T A G C T T C T A C A C C C T T 3′

    • #91632
      jonmoulton
      Participant

      For this mRNA:
      AAGGGUGUAGAAGCUAAGGGU

      The antisense is likely:
      ACCCTTAGCTTCTACACCCTT

      The sense is likely:
      AAGGGTGTAGAAGCTAAGGGT

      All sequences are written in standard 5′ -> 3′ direction.

      The reason I write "likely" is that there might be a pre-mRNA splicing event within the sequence that produces the mature mRNA strand. If so, the DNA sequence would be interrupted by an intron.

      If there is no splicing event, the mRNA sequence is the same as the sense sequence. Be careful, this is not how the sequences were shown in some of the previous discussion.

Viewing 3 reply threads
  • You must be logged in to reply to this topic.