How to read this tricky electropherogram?

Viewing 1 reply thread
  • Author
    Posts
    • #18003
      kabtq9s
      Participant

      I am doing an exercise to find the sequence of this electropherogram and confirming the results in NCBI Blast site. I wrote the sequence on the graph to the best of my ability of ~100 bp segments and searched them in Blast… nothing came up. All what I know is that this is a human gene. Any ideas?

      Here are the three sequences and the actual graph

      lane (1)
      AAAGTGCATCTCCTCCGACATTGGAGGATCCCAAGCTCTCATGTTGCCCTTATTGTCACCAGTGACATTTATTCCAAACAGGAGTCCTTCGGGCCAGCAAA

      lane (2)
      GCTGCCCAGGCTTAGCTGCGAGCCCGTCATGGAGAAAAAGCTCAGAGAAAAGCAGTCTGTTGGAGAATGGGACAGTCACCAGAGACACCTCGTGGGGCTCAGCGGTTCT

      lane (3)
      GAACAGTACCCCGACTGGCCAGCCGAGACATGTTGACCATCCCACCCCATGCGAGCTCATCAAGGAAAGACTAAGTCAGAGAGTCCTCTCTGAC

      Image link
      https://mysowar.files.wordpress.com/2015/02/img.jpg

    • #115664
      jonmoulton
      Participant

      Do you know if this is genomic DNA or cDNA? If not, you should BLAST against both the RNA sequences and the genomic DNA sequence.

Viewing 1 reply thread
  • You must be logged in to reply to this topic.