Biology Forum › Genetics › Need help~!!!!
- AuthorPosts
- March 24, 2007 at 12:08 pm #7255
aznliParticipantHey everyone, Im new here.
I got free questions to ask you all, maybe seems easy but me dumb. 😳
So they are:1.A biochemist isolated and purified the molecules needed for DNA replicaition. When she added some DNA, replication occured, but the DNA molecules were defective. Each consisted of a normal strand, paired with numerous segements of DNA a few hundreds of nucleotides long.
What had she probably left out of the mixture? Explain.a) DNA polymerase
b)Okazaki fragments
c)nucleotides
d)ligase
e)primers2. Huntington’s disease is a rare, dominatly inherited disease of the nervous system. If a man with one copy of the Huntington’s allele and an unaffected woman have children, what is the probability that(show working out):
(a) their 1st child will develp Huntington’s disease?
(b) their 1st two children will develop Huntington’s disease?
(c) their 1st child be a girl and she will develop Huntington’s disease?3.The following is the base sequence of a strand of DNA:
5′ TCACACGGGCCACTCTTGCAT 3′
i) give that base sequence of the mRNA transcribed from it and identify the 5′ and 3′ endsii) Look at a table of genetic codes. what string of amino acids would result from the translation of this mRNA(make sure you consider the direction in which translation proceeds)?
That is all everyone, please help me with these questions.
Thanks you all
🙂
[/b] - March 24, 2007 at 1:55 pm #70470Dr.SteinParticipant
Try to answer it by yourself, then we will discuss it togethe here ok? That’s how this board works 🙂
- March 25, 2007 at 3:42 am #70496aznliParticipant
ok i will try,
so far, for question 1,
My answer is (b) okazaki fragments, because okazaki fragments can help to link the laggin strands and in the question it mentioned "paired with numerous segments of DNA a few hundreds of nucleotides long" that i assume theres lagging strands.
so am i right? - March 26, 2007 at 12:13 am #70512mjolnirParticipantquote Dr.Stein:Try to answer it by yourself, then we will discuss it togethe here ok? That’s how this board works 🙂
Thankyou Dr Stein. I put these 3 questions in a takehome quiz for AZNLI and 359 other students. Most of them seem to be doing it in the traditional way. I am happy for students to talk to one another about projects, but simply asking for the answers on a web site is hardly an educational experience. Could you hold off answers till the due date (Wednesday Oz time).
- March 26, 2007 at 2:40 am #70513Dr.SteinParticipant
@mjolnir:
So, you are aznli’s teacher? Well, I am a teacher too so that’s all I can do: asking them to try it first by themselves before we have a discussion about it. I am known as "a teacher who will answer the question with question" 😆 According to my experience, it is a good way to "boost" students to study. Sometimes they know the answer but they just don’t try to answer. Sometimes we need to guide them to find the answer but actually they themselves who will find it 😉Nice to meet you here, mjolnir 🙂
- AuthorPosts
You must be logged in to reply to this topic.
