qPCR primer design – possible off-target

Viewing 4 reply threads
  • Author
    Posts
    • #14894
      PDavidsen
      Participant

      Hi all,

      I’m designing primers for SYBRGreen-based qPCR (using the software Primer3).
      I’ve tried to check the specificity of the primers by blasting them. However, one of the potential off-targets given by Primer-BLAST is:

      code :product length = 196
      Forward primer 1 AAGCAGAAAACCAGCAGCTC 20
      Template 3134 C..G..C.C.G......... 3153

      Forward primer 1 AAGCAGAAAACCAGCAGCTC 20
      Template 3329 C......C.C.AG....... 3310

      Anyone how would like to share their thoughts on this potential "forward-forward" problem.

      NB. The annealing temperature will be 60 C

      Kind regards

    • #104723
      JackBean
      Participant

      does that mean, that it binds with five residues with such big gaps? I wouldn’t care about that.

    • #104726
      PDavidsen
      Participant

      No, the dots mean perfect complementarity between primer and template. So the forward primer will/might anneal with 5 mismatches two places on the same template (196 bp between the two binding sites)

    • #104731
      JackBean
      Participant

      I see now 🙄

      Yes, there is posibility, that you could get some amplicon. You could try more stringent conditions or some probe for your gene

    • #104758
      canalon
      Participant

      It should still work, but that will decrease your PCR efficiency, and if you are working with multiple strains/subjects, the effect will vary and not be competely correlate with your control. So I would avoid that particular combination if at all possible.

Viewing 4 reply threads
  • You must be logged in to reply to this topic.