Biology Forum Genetics Visualization of DNA

2 voices
2 replies
  • Author
    Posts
    • #219229
      SystemRGB
      Participant

      vis

      Visualization of DNA sequence invented in 2015 by Polish scientist Gregory Podgorniak,
      above this sequence –

      GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

      this type of sequence can be a recording of a single gene – an unit of heredity.

      much more here: http://sresearch.scienceontheweb.net/visualization.php

    • #219242
      Marty
      Participant

      Thanks for helping with this. Very useful and interesting.

    • #219244
      SystemRGB
      Participant

      Thank you for your post, Marty

You must be logged in to reply to this topic.

Members

  • Profile picture of Sdvillacure
    Active 2 hours, 24 minutes ago
  • Profile picture of Tutoroot
    Active 3 hours, 34 minutes ago
  • Profile picture of Vix
    Active 11 hours, 13 minutes ago
  • Profile picture of LloydBap
    Active 12 hours, 41 minutes ago
  • Profile picture of ThomasSpomo
    Active 16 hours, 53 minutes ago