Biology Forum Genetics Visualization of DNA

2 voices
1 reply
  • Author
    Posts
    • #219229
      SystemRGB
      Participant

      vis

      Visualization of DNA sequence invented in 2015 by Polish scientist Gregory Podgorniak,
      above this sequence –

      GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

      this type of sequence can be a recording of a single gene – an unit of heredity.

      much more here: http://sresearch.scienceontheweb.net/visualization.php

    • #219242
      Marty
      Participant

      Thanks for helping with this. Very useful and interesting.

You must be logged in to reply to this topic.

Members

  • Profile picture of Vix
    Active 9 hours, 7 minutes ago
  • Profile picture of Marty
    Active 19 hours, 19 minutes ago
  • Profile picture of Izzy
    Active 19 hours, 19 minutes ago
  • Profile picture of Andrea Kortig
    Active 1 day, 17 hours ago
  • Profile picture of diggavemo
    Active 1 day, 19 hours ago