Visualization of sequences of nucleotides, sequence of DNA

Viewing 9 reply threads
  • Author
    Posts
    • #18086
      SystemRGB
      Participant

      Sequence of 215 nucleotides x 3

      TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

      CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

      CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

      more informations you can find here:
      http://studia.scienceontheweb.net/visualization.php

    • #115749
      SystemRGB
      Participant

      Sequence of 744 nucleotides

      GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

    • #115751
      SystemRGB
      Participant

    • #115759
      SystemRGB
      Participant

      the author of visualization and application: Gregory Podgorniak, Poland (2015)

    • #116428
      SystemRGB
      Participant

      see this again

    • #117261
      SystemRGB
      Participant

      above visualization is basing on visualization of quaternary numeral system

    • #117853
      Counter
      Participant

      Yes but they are just letters. To make it REAL you could divide by 0?

      Base(1)=(((Thymine+1)/(0+1))-1)=((2Thymine/1)-1)=(2Thymine-1)=Thymine
      Base(2)=(((Cytosine+1)/(0+1))-1)=((2Cytosine/1)-1)=(2Cytosine-1)=Cytosine
      Base(3)=(((Adenine+1)/(0+1))-1)=((2Adenine/1)-1)=(2Adenine-1)=Adenine
      Base(4)=(((Guanine+1)/(0+1))-1)=((2Guanine/1)-1)=(2Guanine-1)=Guanine
      1《a
      1《b
      1《c
      i=i+Base(a)+Base(b)+Base(c)
      c《4
      b《4
      a《4

      • #117855
        Counter
        Participant

        Base(1)=(((Thymine+1)/(0+1))-1)=((2Thymine/1)-1)=(2Thymine-1)=Thymine
        Base(2)=(((Adenine+1)/(0+1))-1)=((2Adenine/1)-1)=(2Adenine-1)=Adenine
        Base(3)=(((Cytosine+1)/(0+1))-1)=((2Cytosine/1)-1)=(2Cytosine-1)=Cytosine
        Base(4)=(((Guanine+1)/(0+1))-1)=((2Guanine/1)-1)=(2Guanine-1)=Guanine
        1《a
        1《b
        1《c
        d=d+1
        I(d)=Base(a)+Base(b)+Base(c)
        c《4
        b《4
        a《4

        ??

        • This reply was modified 7 months, 2 weeks ago by Counter.
    • #117854
      Counter
      Participant

      SystemRGB, according to this there are only 64 sequences.

      https://images.app.goo.gl/rx8Hu7BJS46TjTQP9

    • #117870
      Counter
      Participant

      Could be…

      Hi. Please read what i=?

      Base(1)=(((Thymine+1)/(0+1))-1)=((2Thymine/1)-1)=(2Thymine-1)=Thymine
      Base(2)=(((Adenine+1)/(0+1))-1)=((2Adenine/1)-1)=(2Adenine-1)=Adenine
      Base(3)=(((Cytosine+1)/(0+1))-1)=((2Cytosine/1)-1)=(2Cytosine-1)=Cytosine
      Base(4)=(((Guanine+1)/(0+1))-1)=((2Guanine/1)-1)=(2Guanine-1)=Guanine
      1《a
      1《b
      1《c
      i=i+Base(a)+Base(b)+Base(c)
      c《4
      b《4
      a《4

      It’s every genetic possibility.

      https://images.app.goo.gl/FqL8gZenND3zkcj59

      So, i=TTTTTATTCTTG…

    • #117260
      SystemRGB
      Participant

      above visualization is basing on visualization of quaternary numeral system

      Quaternary numeral system

      below you can see numbers in decimal and quaternary systems, which you can see on the image:

      910, 268, 279, 395, 987, 796, 987, 363, 188, 967, 133, 705, 709, 119, 423, 774, 804, 866, 777, 875, 568, 329, 495, 241, 427, 186, 337, 107, 579, 1002, 720, 480, 668, 775, 513, 967, 240, 490, 191, 887, 806, 298, 67

      32032, 10030, 10113, 12023, 33123, 30130, 33123, 11223, 02330, 33013, 02011, 23001, 23011, 01313, 12213, 30012, 30210, 31202, 30021, 31223, 20320, 11021, 13233, 03301, 12223, 02322, 11101, 01223, 21003, 33222, 23100, 13200, 22130, 30013, 20001, 33013, 03300, 13222, 02333, 31313, 30212, 10222, 01003

Viewing 9 reply threads
  • You must be logged in to reply to this topic.