Visualization of sequences of nucleotides, sequence of DNA

Viewing 8 reply threads
  • Author
    Posts
    • #18086
      SystemRGB
      Participant

      Sequence of 215 nucleotides x 3

      TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

      CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

      CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

      more informations you can find here:
      http://studia.scienceontheweb.net/visualization.php

    • #115749
      SystemRGB
      Participant

      Sequence of 744 nucleotides

      GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

    • #115751
      SystemRGB
      Participant

    • #115759
      SystemRGB
      Participant

      the author of visualization and application: Gregory Podgorniak, Poland (2015)

    • #116428
      SystemRGB
      Participant

      see this again

    • #117261
      SystemRGB
      Participant

      above visualization is basing on visualization of quaternary numeral system

    • #117853
      Counter
      Participant

      Yes but they are just letters. To make it REAL you could divide by 0?

      Base(1)=(((Thymine+1)/(0+1))-1)=((2Thymine/1)-1)=(2Thymine-1)=Thymine
      Base(2)=(((Cytosine+1)/(0+1))-1)=((2Cytosine/1)-1)=(2Cytosine-1)=Cytosine
      Base(3)=(((Adenine+1)/(0+1))-1)=((2Adenine/1)-1)=(2Adenine-1)=Adenine
      Base(4)=(((Guanine+1)/(0+1))-1)=((2Guanine/1)-1)=(2Guanine-1)=Guanine
      1《a
      1《b
      1《c
      i=i+Base(a)+Base(b)+Base(c)
      c《4
      b《4
      a《4

      • #117855
        Counter
        Participant

        Base(1)=(((Thymine+1)/(0+1))-1)=((2Thymine/1)-1)=(2Thymine-1)=Thymine
        Base(2)=(((Adenine+1)/(0+1))-1)=((2Adenine/1)-1)=(2Adenine-1)=Adenine
        Base(3)=(((Cytosine+1)/(0+1))-1)=((2Cytosine/1)-1)=(2Cytosine-1)=Cytosine
        Base(4)=(((Guanine+1)/(0+1))-1)=((2Guanine/1)-1)=(2Guanine-1)=Guanine
        1《a
        1《b
        1《c
        d=d+1
        I(d)=Base(a)+Base(b)+Base(c)
        c《4
        b《4
        a《4

        ??

        • This reply was modified 4 weeks ago by Counter.
    • #117854
      Counter
      Participant

      SystemRGB, according to this there are only 64 sequences.

      https://images.app.goo.gl/rx8Hu7BJS46TjTQP9

    • #117870
      Counter
      Participant

      Could be…

      Hi. Please read what i=?

      Base(1)=(((Thymine+1)/(0+1))-1)=((2Thymine/1)-1)=(2Thymine-1)=Thymine
      Base(2)=(((Adenine+1)/(0+1))-1)=((2Adenine/1)-1)=(2Adenine-1)=Adenine
      Base(3)=(((Cytosine+1)/(0+1))-1)=((2Cytosine/1)-1)=(2Cytosine-1)=Cytosine
      Base(4)=(((Guanine+1)/(0+1))-1)=((2Guanine/1)-1)=(2Guanine-1)=Guanine
      1《a
      1《b
      1《c
      i=i+Base(a)+Base(b)+Base(c)
      c《4
      b《4
      a《4

      It’s every genetic possibility.

      https://images.app.goo.gl/FqL8gZenND3zkcj59

      So, i=TTTTTATTCTTG…

Viewing 8 reply threads
  • You must be logged in to reply to this topic.