Visualization of sequences of nucleotides, sequence of DNA

Viewing 5 reply threads
  • Author
    Posts
    • #18086
      SystemRGB
      Participant

      Sequence of 215 nucleotides x 3

      TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

      CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

      CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

      more informations you can find here:
      http://studia.scienceontheweb.net/visualization.php

    • #115749
      SystemRGB
      Participant

      Sequence of 744 nucleotides

      GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

    • #115751
      SystemRGB
      Participant

    • #115759
      SystemRGB
      Participant

      the author of visualization and application: Gregory Podgorniak, Poland (2015)

    • #116428
      SystemRGB
      Participant

      see this again

    • #117261
      SystemRGB
      Participant

      above visualization is basing on visualization of quaternary numeral system

Viewing 5 reply threads
  • You must be logged in to reply to this topic.