Hi, here’s a question I’ve pondered for awhile, hopefully I can explain it clearly:

If I took a sequenced gene (like a long string of ACAGATGTGGTGATTCAGATGATCCA etc…), could I write out those DNA “instructions” into everyday language that explains step by step what the gene is accomplishing?

Like this:

“ACAGATGTGGT: now the gene is doing X”

“GATTCAGATGA: now the gene is doing X”

Is this something I could feasibly learn to do? I have a good understanding of general science but I’m by no means a biology expert.

Thanks