Biology Forum › Molecular Biology › DNA into everyday speech
This topic contains 1 voice and has 0 replies.
1 voice
0 replies
- AuthorPosts
- June 3, 2023 at 10:48 pm #219732
D
ParticipantHi, here’s a question I’ve pondered for awhile, hopefully I can explain it clearly:
If I took a sequenced gene (like a long string of ACAGATGTGGTGATTCAGATGATCCA etc…), could I write out those DNA “instructions” into everyday language that explains step by step what the gene is accomplishing?
Like this:
“ACAGATGTGGT: now the gene is doing X”
“GATTCAGATGA: now the gene is doing X”
Is this something I could feasibly learn to do? I have a good understanding of general science but I’m by no means a biology expert.
Thanks
- AuthorPosts
Topic tags
You must be logged in to reply to this topic.