Biology Forum › Cell Biology › DNA Sequence
- AuthorPosts
- October 15, 2005 at 9:14 pm #2174
stylishgurl2001
ParticipantOkay I am not very good at biology at all and can’t figure out this question. I have been searching for an answer for hours on how to do this.
We are given a mRNA sequence 5′ GAUGGAGUCUAAGCGGAUGGA3′ and our asked 2 questions.
1. What is the informational DNA sequence that encodes for the word for this portein? Be sure to note the 5′ & 3′ ends.
2. What is the antisense DAN sequence that would be found in the template starnd for the information sequence that you submitted as an answer for the previous question? Be sure to note the 5′ & 3′ ends.
Can somebody PLEASE help me with this??
- October 16, 2005 at 11:11 am #31001
sdekivit
Participantquote stylishgurl2001:Okay I am not very good at biology at all and can’t figure out this question. I have been searching for an answer for hours on how to do this.We are given a mRNA sequence 5′ GAUGGAGUCUAAGCGGAUGGA3′ and our asked 2 questions.
1. What is the informational DNA sequence that encodes for the word for this portein? Be sure to note the 5′ & 3′ ends.
2. What is the antisense DAN sequence that would be found in the template starnd for the information sequence that you submitted as an answer for the previous question? Be sure to note the 5′ & 3′ ends.
Can somebody PLEASE help me with this??
1) is easy, since the coding strand has the same code as mRNA only uracil is thymidine in DNA.
2) use complementary basepairing. Remember 3′ and 5′ are antiparallel, thus you should begin at the right of your given code.
- AuthorPosts
You must be logged in to reply to this topic.