Viewing 2 reply threads
  • Author
    Posts
    • #15714
      aves
      Participant

      There is dna sequence, I find promoter regions on this sequence and question that: (- 35 REGİON: TTGACA, -10 REGİON: TCCAAT)
      Please answer mutation questions on Pribnow sequences
      1-change last T residue of pribnow sequence to A,
      2-change first A residue of pribnow sequence to T residue,
      Please answer mutation question on -35 sequences
      1-change second T residue of -35 sequences to A residue,
      2-change C residue of -35 region to A residue
      What are the affects of these mutations on transcription?
      sequence:
      5’cttgccatgctaaaggacgtcacattTTGACAgcacaatcttaataaggtttgacatTCCAATcagccccaccttgacacgctctggcccccttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgcttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgttgacactttatgcttccggctcgtataataccctcaccctccaacatgaggatttgcgcatgaccacaatggcggccgccaccctgctgcgcgcgacgccccacttcagcggtctcgc
      cgccggccggaccttcctgctgcagggtctgttgtgaccacaatagtaacatccctagacgtaagcggcttttttgcagggtttttgggccctaaaggctccttttggagcctttttttgagcagggtttttgggcccgggctaaaggacgtcacattttgatttttgggcccgggctaaag-3

    • #108255
      daniel.kurz
      Participant

      Read your textbook? This sounds like homework that you were assigned for a molecular genetics course.

    • #108274
      aves
      Participant

      yes this is my homework, but the problem is that; there is no textbook! can you help?

Viewing 2 reply threads
  • You must be logged in to reply to this topic.