There is dna sequence, I find promoter regions on this sequence and question that: (- 35 REGİON: TTGACA, -10 REGİON: TCCAAT)
Please answer mutation questions on Pribnow sequences
1-change last T residue of pribnow sequence to A,
2-change first A residue of pribnow sequence to T residue,
Please answer mutation question on -35 sequences
1-change second T residue of -35 sequences to A residue,
2-change C residue of -35 region to A residue
What are the affects of these mutations on transcription?
sequence:
5’cttgccatgctaaaggacgtcacattTTGACAgcacaatcttaataaggtttgacatTCCAATcagccccaccttgacacgctctggcccccttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgcttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgttgacactttatgcttccggctcgtataataccctcaccctccaacatgaggatttgcgcatgaccacaatggcggccgccaccctgctgcgcgcgacgccccacttcagcggtctcgc
cgccggccggaccttcctgctgcagggtctgttgtgaccacaatagtaacatccctagacgtaagcggcttttttgcagggtttttgggccctaaaggctccttttggagcctttttttgagcagggtttttgggcccgggctaaaggacgtcacattttgatttttgggcccgggctaaag-3