Biology Forum › Molecular Biology › promoter mutations effects
- AuthorPosts
- November 20, 2011 at 5:52 pm #15714
aves
ParticipantThere is dna sequence, I find promoter regions on this sequence and question that: (- 35 REGİON: TTGACA, -10 REGİON: TCCAAT)
Please answer mutation questions on Pribnow sequences
1-change last T residue of pribnow sequence to A,
2-change first A residue of pribnow sequence to T residue,
Please answer mutation question on -35 sequences
1-change second T residue of -35 sequences to A residue,
2-change C residue of -35 region to A residue
What are the affects of these mutations on transcription?
sequence:
5’cttgccatgctaaaggacgtcacattTTGACAgcacaatcttaataaggtttgacatTCCAATcagccccaccttgacacgctctggcccccttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgcttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgttgacactttatgcttccggctcgtataataccctcaccctccaacatgaggatttgcgcatgaccacaatggcggccgccaccctgctgcgcgcgacgccccacttcagcggtctcgc
cgccggccggaccttcctgctgcagggtctgttgtgaccacaatagtaacatccctagacgtaagcggcttttttgcagggtttttgggccctaaaggctccttttggagcctttttttgagcagggtttttgggcccgggctaaaggacgtcacattttgatttttgggcccgggctaaag-3 - November 21, 2011 at 2:27 am #108255
daniel.kurz
ParticipantRead your textbook? This sounds like homework that you were assigned for a molecular genetics course.
- November 21, 2011 at 7:43 am #108274
aves
Participantyes this is my homework, but the problem is that; there is no textbook! can you help?
- AuthorPosts
You must be logged in to reply to this topic.