Viewing 3 reply threads
  • Author
    Posts
    • #7637
      Krux11
      Participant
      quote :

      Is the gene code given the mRNA, tRNA, the templating strand of DNA or the coding strand of DNA.

      I’m not sure what the question is asking, is there something ‘given’ to gene code?

    • #72621
      blcr11
      Participant

      Is this a "check all that apply" kind of question? With the exception of tRNA, everything else "codes" for a protein in some sense–and you can even argue that tRNA carries some of the code, just not enough by itself to encode a protein. The closest direct connection between a protein product and its "code" I guess would be mRNA, but only because it is the mRNA that is translated from nucleic acid into protein on the ribosome. But the "code" exists all the way back to both strands of the DNA. I’m not entirely happy with the way the question is worded.

    • #72638
      Krux11
      Participant

      Oh wait, my apologies. On the back of the sheet there is gene code lol. So the given gene is something like: atgccggatgcagcatgctatatagctgc…

      This would be the coding strand correct? Since it has thymine it cannot be the RNA and the coding strand is the same as the mRNA which essentially codes for the proteins correct?

    • #72687
      david23
      Participant

      yes it’s the coding strand hahaha. simple multiple choice. You were thinking way too much, but you were pretty right, so good luck with the rest of whatever you are doing.

Viewing 3 reply threads
  • You must be logged in to reply to this topic.