Biology Forum › Molecular Biology › Tricky translation question, can someone help please?
- AuthorPosts
- June 15, 2009 at 5:35 pm #11464
0rion
ParticipantHey Guys,
So i got my biology test back, and I did pretty well, but there was one on there that whacked me between the eyes, here it is…
15.The following DNA sequence shows a gene encoding a small peptide. The promoter region is given in brackets. The three stop codons are UAA, UAG and UGA.
5′ (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3′
3′ (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC 5′How many amino acids long will the smalll protein encoded by this gene be?
a.3
b.4
c.5
d.6
e.7Ok, so first piece of knowledge needed is the obvious, 3 bases to an amino acid, and when the three bases are UAA UAG or UGA the peptide stops.
Next, DNA is read in the 3′ to 5′ direction, so the strand of RNA should read:
5′ (AUGACGUAUAA)UGACCGUACAUGAGUAAUACAUAAAUCAG 3′
Have i done it right so far?
Because this is where i lose the plot, i’m not 100% sure what the promoter region is, and the first codon is UGA… therefore it should only be 1 amino acid long? :SThanks in advance guys,
- June 15, 2009 at 11:29 pm #91362
jonmoulton
ParticipantThe promoter is a sequence outside the coding region where regulatory proteins bind the DNA and help a polymerase to hook onto the DNA and start transcription.
You need to start with a methionine codon (AUG) and then count triplets (including the methionine) until you reach the stop (which you don’t count as an amino acid).
- AuthorPosts
You must be logged in to reply to this topic.